MBT scarpe presa,TGF  β3 eukaryotic exp

kingu32vgg4

TGF  β3 eukaryotic expression vector was transfected into bone marrow stromal cells to promote their differentiation to the cartilage Study

Of: Zheng Dong, Shu-Hua Yang, Yuan Xiaomei, Li Jin, Feng Yong, Xu Liang, Mei Rongcheng
Abstract purposes] Build transforming growth factor (TGF  β3) to strengthen the green fluorescent protein containing green eukaryotic expression plasmid pIRES2  EGFP  TGF  β3, and then the plasmid transfected bone marrow stromal cells (Marrow stromal cells, MSCs) and to promote the differentiation of MSCs to the cartilage. [Method] RT  PCR method from rat embryos to extract the DNA length TGF  β3, first connect to pMDl8  T vector, amplified, purified and sequenced by DNA sequencing to determine the correctness of inserted target gene sequence, and then with EcoRI, PstI endonuclease primers, from pMD18  T will be the full-length TGF  β3 amplified again, and finally with the restriction sites of the TGF  β3 full-length inserted into the eukaryotic plasmid pIRES2  EGFP in the eukaryotic expression vector pIRES2  EGFP  TGF  β3. Rat MSCs,[link widoczny dla zalogowanych], application of positive liposome pIRES2  EGFP  TGF  β3 in transfected into MSCs, 24 h were observed under a fluorescence microscope after protein expression, flow cytometry MSCs transfection efficiency; Westen Blot Detection of TGF  β3 protein; after the cell pellets cultured MSCs were detected in the first 7,14,21,28 d cartilage matrix collagen Ⅱ, the expression of collagen X and Aggrecan also detected with toluidine blue proteoglycan (proteoglycan) expression. [Results] sequencing and restriction analysis results show that the successful construction of the pIRES2  EGFP  TGF  β3 plasmid transfected MSCs after the transfection efficiency of 30%. Westen Blot results showed that TGF  β3 expression was successful, the next cell in the process of pellet culture, the transfected MSCs were successfully induced to chondrogenic differentiation.
Key words Cloning of transforming growth factor β3; cartilage differentiation; cartilage tissue engineering; cartilage repair; eukaryotic cells; bone marrow stromal stem cells
Transforming growth factor TGF (transforming growth factor) in cartilage development and differentiation has an important role in the TGF family, TGF-β3 in mesenchymal cells (mesochymal cells MCs) express the most obvious , and MCs during the differentiation and development of a wide range of biological effects, including bone marrow stromal stem cells in promoting (marrow stromal cells, MSCs), to the process of cartilage cells is particularly evident in the role of [1]. The results show that, TGF  β3 in the differentiation of MSCs to the cartilage cells in the process of accumulation, proliferation and differentiation stages played an important regulatory role, and the cultured MSCs by adding TGF  β3, have been successful and efficient induction of MSCs into chondrocytes [2], so scholars will TGF  β3 application of growth factors such as treatment of articular cartilage injury and repair, a new and important directions. But merely adding exogenous TGF  β3 difficult to study TGF  β3 in vivo induction of differentiation of MSCs to the cartilage, which can not be therapeutic research. In vivo direct injection of pure TGF  β3 promote differentiation of MSCs to the cartilage and repair cartilage in the experiment was done abroad,[link widoczny dla zalogowanych], but the side effects, efficacy can not be sustained [3]. The TGF  β3 transfected into MSCs, through paracrine and autocrine way work can avoid the side effects of TGF  β3 play a lasting effect. The experiment in building a pIRES2  EGFP  TGF  β3 eukaryotic expression vector based on the in vitro transfection and induction of differentiation of MSCs into chondrocytes experimental study, and to build further in vivo experiments and for gene therapy vectors, such as Adenovirus has provided a foundation.
1 Materials and methods
1.1 Materials plasmid pIRES2  EGFP, bacteria DH5α (our laboratory); PCR Marker, restriction enzymes EcoRI, Pst I, pMD18  T Simple Vector, gel extraction kit was purchased from TakaRa company; T4 DNA ligase, reverse transcriptase kit, Taq DNA polymerase for the MBI's products; Trizol kit, qualitative lipid Lipofectamine TM2000 transfection kit (Invetrogen company); small amount of plasmid extraction purification kit (Shanghai Hua Shunsheng Biological Engineering Company); DMEM, fetal bovine serum, trypsin, Ⅱ collagenase, hyaluronidase as GBICO products; other reagents were analytical grade domestic and imported.
1.2 Methods
1.2.1 TGF  β3 cDNA amplification to take a week SD rats (Animal, Tongji Medical College to provide) embryonic mesoderm tissue (fetal germ tissue), homogenized with Trizol kit extracted RNA, 2 μg of total RNA extracted by reverse transcription kit transcribed into cDNA, PCR amplification of TGF  β3-line coding sequence (full length), upstream primer: 5'GCCACCATGAAGATGCACTTACAAAGG 3 'downstream primer 5'GCCTCAGCTGCACTTACACGACTTC 3 ', the length of 1242bp. Reaction conditions: 94 ℃ denaturation 3 min, then 94 ℃ 30 s, 59 ℃ 30 s, 72 ℃ 2 min 30 cycles, then 72 ℃ for 10 min, products were agarose (1%) gel electrophoresis, about the size of cut the 1242bp bands recovered by gel extraction kit and purified.
1.2.2 T vector instructions given by vector system for TGF  β3 PCR products and pMDl8  T Simple Vector connections. Connect products added to 100 μl of competent bacteria DH5α, placed on ice 30 min. After heating 42 ℃ 90 s, on ice 1 min. Then add 890 μl SOC medium,[link widoczny dla zalogowanych], 37 ℃ shaking 60 min, 8 000 r / min centrifugation 5 min, supernatant 900 μl, mix the broth, take 100 μl coated plates in the presence of X  Gal, IPTG, Amp The L  cultured on agar plate medium to form a single colony, selected white colonies using colony PCR, confirmed that the length of the vector into the fragment size.
1.2.3 gene (TGF  β3) of the sequencing and the introduction of restriction sites Extraction and purification of plasmid pMDl8  T  TGF  β3, adjust the DNA concentration of 0.2 g / L, by Shanghai Invitrogen Technology Co., Ltd. completed sequencing, sequenced according to the TGF  β3 Genebank complete sequence homology comparison. Then the plasmid pMDl8  T  TGF  β3 as a template for PCR specific amplification again, and the introduction of the primers endonuclease sites, full-length gene was amplified, upstream primer: 5'GC GAATTC GCCACCATGAAGATGCAC 3 ' , downstream primer: 5'GTCTGCAGAGCTGCACTTACACGACTT 3 ', underlined are the EcoR I and Pst I restriction site. Amplification product size is 1249bp. Reaction conditions: 94 ℃ denaturation 3 min, then 94 ℃ 30 s, 56 ℃ 30 s,[link widoczny dla zalogowanych], 72 ℃ 2 min 30 cycles, then 72 ℃ for 10 min. The amplified products were 1% agarose gel electrophoresis, the cut size of about 1249bp of the DNA fragment recovery and purification.
1.2.4 Construction of recombinant plasmid pIRES2  EGFP  TGF  β3 TGF  β3 PCR products and plasmid pIRES2  EGFP were treated with EcoR I, Pst I digested the reaction system reference manual. Recovery after agarose (20 μl), T4 ligase overnight at 16 ℃ directional connection. Connections were transformed into DH5α competent bacteria. The positive colonies were picked and amplified in extraction and purification of plasmid restriction enzyme digestion, with EcoR I, Pst I double digestion, 1% agarose gel electrophoresis with enzyme products.
1.2.5 MSCs Isolation and purification of 1-month-old SD rats were taken in sterile conditions, remove the rat femur and humerus, with the complete medium (20% FBS, DMEM low glucose, VitC 50 μg / ml, penicillin 100 u / ml, streptomycin 100 μg / ml amphotericin R 0.25 μg / ml) washing the bone marrow cavity,[link widoczny dla zalogowanych], the cell suspension to obtain full playing uniform, adjusting the cell concentration of 1 × 104 after inoculated into culture flasks. After inoculation 48 h 1st-for-fluid cells was observed adherent conditions and then every 3 d for a second fluid, cell fusion about 60% to 70% of the passage, inverted phase contrast microscope observation of cell growth, to be cell mass to 3rd generation (3 passage, P3), press the surface markers (CD34, CD45 and STRO  1, CD105) by flow cytometry identification of MSCs purity.
1.2.6 Determination of the growth curve of P3 MSCs obtained after digestion P3 MSCs diluted 1 × 103 cells were inoculated into 96-well plates. Were the first 1 ~ 8 d, to do with the MMT cell activity detection, growth curve chart.
1.2.7 plasmid pIRES2  EGFP  TGF  β3 take P3 MSCs transfected cells to 1 × 105 per well plated in 24-well plates. 37 ℃, 5% CO2 adherent cultured 24 h after the medium was changed. Measured according to P3 MSCs growth curve, until the cells entered the logarithmic growth phase, the first 3 d, conventional cationic lipid Lipofectamine TM2000 mass transfer. In accordance with product instructions transfection, transfection medium was serum-free medium. Experimental group, the recombinant plasmid pIRES2  EGFP  TGF  β3 transfected MSCs; negative control group transfected with pIRES2  EGFP same MSCs; blank transfected without any plasmid.
1.2.8 Westen Blot Detection of TGF  β3 expression 48 h after transfection medium was changed to collect the experimental group, negative control group, the supernatant by dialysis bag + PEG concentrated, Westen Blot Detection of TGF  β3 protein content.
1.2.9 MSCs transfected cell pellets of the culture [4], the experimental group and the negative control group transfected MSCs, after digestion were inoculated into the culture bottle and cultured. Bottom to be about 70% of cell confluence, the trypsin digestion, take 2 × 105 cells, each shift to the EP tube, 1 000 r / min, centrifuge 10 min. With a trace of sample cell pellet gun accidentally block the blow, the small dish were inoculated, 37 ℃, 5% CO2, saturated humidity were cultured with complete medium, 24 h to be adherent cell mass after for using part of the induction medium (FBS 5%, DMEM high glucose, 10  7 μmol / L dexamethasone, 50 μg / ml vitC) continued to train. Each group (experimental group and the negative control group) were cultured for 10 pellets.